Cells were stained with Texas redCconjugated phalloidin (Molecular Probes) for F-actin
Cells were stained with Texas redCconjugated phalloidin (Molecular Probes) for F-actin. cDNA and ROK cDNA JNJ-10229570 were gifts from P. Cohen (University or college of Dundee, Dundee, Scotland, UK) JNJ-10229570 and T. Leung (National University or college of Singapore, Singapore), respectively, and cloned into pFASTBAC HT plasmid. Rho-kinase and GST tagged ZIP kinase were purified from Sf9 cells with Ni2+-nitrilotriacetic acid-agarose (QIAGEN) or glutathione-Sepharose 4B as explained previously (Niiro and Ikebe, 2001). SM-1 peptide was synthesized as explained previously (Ikebe et al., 1987b). Y27632 was provided by Yoshitomi Pharmaceutical Industries, Ltd., and ML-7 was purchased from Calbiochem. Antibodies Rabbit Polyclonal to RPC3 A phosphopeptide KKRPQRAphosphoTSNVFAMC was coupled to keyhole limpet hemocyanin at COOH-terminal cysteine residue. A pTS Ab was affinity purified using the phosphopeptide and then soaked up with unphosphopeptide. A pSer19 Ab, ZIP kinase Ab, and phosphorylation-specific Ab against MBS at Thr 641 or Ser799 were explained previously (Komatsu et al., 2000; Niiro and Ikebe, 2001; Takizawa et al., 2002). A rabbit Ab against weighty chain of myosin IIB, MLC20, and MLCK were provided by R. Adelstein (National Institutes of Health, Bethesda, MD), J. Stull (University or college of Texas Southwestern Medical Center, Dallas, TX), and JNJ-10229570 P. de Lanerolle (University or college of Illinois, Chicago, IL), respectively. Anti-MLC20, MBS, ROK, -actin, and paxillin Abs were purchased from Sigma-Aldrich, Covance Study Products Inc., and Transduction Laboratories, respectively. Cell tradition, microinjection, and transfection REF-2A cells (a gift from F. Matsumura, Rutgers University or college, Piscataway, NJ) and NIH3T3 fibroblast cells were managed in DME comprising 10% newborn calf serum. NRK cells (NRK52E; a gift from Y.-L. Wang, University or college of Massachusetts, Worcester, MA) and COS 7 cells were cultured in F12 medium (Sigma-Aldrich) comprising 10% FBS (GIBCO BRL), 2 mM l-glutamine or DME comprising 10% FBS, respectively. Microinjection was performed using a micromanipulator (Transjector 5246; Eppendorf). 0.1mg/ml of ZIP kinase was coinjected with FITC-dextran. For RNAi, the selected sequences were submitted to a BLAST search to JNJ-10229570 ensure that only ZIP kinase gene was targeted. The focusing on sequence of mouse ZIP kinase (“type”:”entrez-nucleotide”,”attrs”:”text”:”AB007143″,”term_id”:”2911153″,”term_text”:”AB007143″AB007143), AAGACAGATGTGGTGCTGATC, related to the coding region 256C276 of ZIP kinase was utilized for siRNA and synthesized by Dharmacon Study. Two times strand siRNA was prepared according to the manufacturer’s protocol (Dharmacon), and transfected using Lipofectamine 2000 (Invitrogen). As a negative control (nonspecific siRNA), human being ZIP kinase (“type”:”entrez-nucleotide”,”attrs”:”text”:”AB022341″,”term_id”:”5162883″,”term_text”:”AB022341″AB022341) siRNA (AAGACGGACGTGGTCCTCATC) was used. siRNA-transfected cells were cultured within the fibronectin (10 g/ml)-coated glass coverslips. Preparation of cell components REF-2A cells were washed and then lysed in buffer I (50 mM Tris-HCl, pH 7.5, 5 mM MgCl2, 0.1 mM EGTA, 5 mM DTT, 5% glycerol, 0.2 mM for 15 min. Protein concentration was determined by the method of Bradford (1976) by using BSA as a standard. For NIH3T3 cells, nuclear and cytosol fractions were prepared from cells treated with siRNA using Nuclear/Cytosol Fractionation Kit (BioVision, Inc.). Immunoprecipitation and immunodepletion The cell components were incubated with either nonspecific rabbit IgGs or anti-ZIP kinase Ab at 4C for 3 h and then protein A-Support (Bio-Rad Laboratories) was added. The immunocomplex was centrifuged, washed three times with wash buffer (0.1 M KCl and Tris-HCl, pH 8.8), and two times with buffer B and utilized for myosin phosphorylation assay. Biochemical methods Urea/glycerol PAGE (Perrie and Perry, 1970) and SDS-PAGE (Laemmli, 1970) were performed as explained previously. MLC20 was phosphorylated by MLCK and JNJ-10229570 PKC (Ikebe and Hartshorne, 1985a; Ikebe et al., 1987a). Immunoblotting was carried out as explained previously using nitrocellulose membranes (Yano et al., 1993; Komatsu et al., 2000). In vitro phosphorylation was performed using buffer comprising 30 mM NaCl, 5 mM MgCl2, 1 M microcystin-LR, 0.2 mM ATP, and 30 mM Tris-HCl, pH 7.5, and 0.2 mM CaCl2 for buffer A and 5 mM EGTA for buffer B. Myosin (0.4 mg/ml) or MBS was phosphorylated in the presence of kinase inhibitors (Y27632, ML-7 in.